Journal: Cancer cell

Article Title: Epidermal Growth Factor Receptor Extracellular Domain Mutations in Glioblastoma Present Opportunities for Clinical Imaging and Therapeutic Development

doi: 10.1016/j.ccell.2018.06.006

Figure Lengend Snippet: (A and B) KM survival curves comparing mice implanted with U87 (A) or HK281 (B) tumors expressing either WT EGFR or EGFRA289V, n = 6 per group.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies EGFR antibody BD Biosciences 61007 Pan-phospho-Tyrosine HRP antibody R&D Systems HAM1676 p42/44 MAPK antibody Cell Signaling Technology 9102 Phospho-p42/44 MAPK antibody Cell Signaling Technology 9101 STAT3 antibody Cell Signaling Technology 4904 Phospho-STAT3 y705 antibody Cell Signaling Technology 9145 AKT antibody Cell Signaling Technology 9272 Phospho-AKT s473 Cell Signaling Technology 4060 Ki67 Santa Cruz Biotechnology Sc-15402 β-Actin Sigma A 3854 mAb806 Biological Production Facility N/A BrdU (clone B44) antibody BD Biosciences BDB347580 Hoechst 33258 Sigma-Aldrich B2883 Bacterial and Virus Strains pLRNL vector Nishikawa et al., 1994 N/A pLV-EF1a-MCS-IRES-Hyg Biosettia cDNA-pLV02 iRFP720 cDNA Zanca et al., 2017 N/A Chemicals, Peptides, and Recombinant Proteins U0126 LC Laboratories U-6770 U0126 Cell Signaling Technology 9903S PD98059 LC Laboratories P-4313 Experimental Models: Cell Lines Human: U87 cells ATCC HTB-14 Human: HK281 GBM-spheres Laboratory of Harley Kornblum, UCLA N/A Experimental Models: Organisms/Strains Mouse: Female NCI Ath/Nu Charles River Labs Strain 563 Mouse: Female J:NU Homozygous The Jackson Laboratory 007850 Oligonucleotides shRNA targeting sequence: shMMP1: CCGGGC TAACCTTTGATGCTATAACCTCGAGGTTATAGC ATCAAAGGTTAGCTTTTTG Sigma TRCN0000372933 shControl: pLKO.1shGFP2 Fenton et al., 2012 N/A Primers for Real Time PCR, see Table S2 This paper N/A Software and Algorithms MUSE Doshi et al., 2016 www.med.upenn.edu/sbia/muse.html FLIRT Jenkinson et al., 2002 fsl.fmrib.ox.ac.uk Cancer Imaging Phenomics Toolkit (CaPTk) Davatzikos et al., (2018) www.med.upenn.edu/sbia/captk.html GLISTRboost Bakas et al., 2016 , Bakas et al., 2017b ipp.cbica.upenn.edu http://www.med.upenn.edu/sbia/glistrboost.html ITK-SNAP Yushkevich et al., 2006 www.itksnap.org ParaView Hansen and Johnson, 2005 www.paraview.org Open in a separate window KEY RESOURCES TABLE Epidermal growth factor receptor (EGFR) extracellular domain (ECD) missense mutations at A289 confer increased invasiveness, increased proliferation, and decreased patient survival in glioblastoma (GBM).

Techniques: Expressing

Journal: Cancer cell

Article Title: Epidermal Growth Factor Receptor Extracellular Domain Mutations in Glioblastoma Present Opportunities for Clinical Imaging and Therapeutic Development

doi: 10.1016/j.ccell.2018.06.006

Figure Lengend Snippet: (A and B) Quantification of U87 glioma cells (A) and HK281 GBM-spheres (B) expressing WT EGFR or EGFRA289V cell invasion following treatment with U0126 (10 μM) or control for 24 hr.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies EGFR antibody BD Biosciences 61007 Pan-phospho-Tyrosine HRP antibody R&D Systems HAM1676 p42/44 MAPK antibody Cell Signaling Technology 9102 Phospho-p42/44 MAPK antibody Cell Signaling Technology 9101 STAT3 antibody Cell Signaling Technology 4904 Phospho-STAT3 y705 antibody Cell Signaling Technology 9145 AKT antibody Cell Signaling Technology 9272 Phospho-AKT s473 Cell Signaling Technology 4060 Ki67 Santa Cruz Biotechnology Sc-15402 β-Actin Sigma A 3854 mAb806 Biological Production Facility N/A BrdU (clone B44) antibody BD Biosciences BDB347580 Hoechst 33258 Sigma-Aldrich B2883 Bacterial and Virus Strains pLRNL vector Nishikawa et al., 1994 N/A pLV-EF1a-MCS-IRES-Hyg Biosettia cDNA-pLV02 iRFP720 cDNA Zanca et al., 2017 N/A Chemicals, Peptides, and Recombinant Proteins U0126 LC Laboratories U-6770 U0126 Cell Signaling Technology 9903S PD98059 LC Laboratories P-4313 Experimental Models: Cell Lines Human: U87 cells ATCC HTB-14 Human: HK281 GBM-spheres Laboratory of Harley Kornblum, UCLA N/A Experimental Models: Organisms/Strains Mouse: Female NCI Ath/Nu Charles River Labs Strain 563 Mouse: Female J:NU Homozygous The Jackson Laboratory 007850 Oligonucleotides shRNA targeting sequence: shMMP1: CCGGGC TAACCTTTGATGCTATAACCTCGAGGTTATAGC ATCAAAGGTTAGCTTTTTG Sigma TRCN0000372933 shControl: pLKO.1shGFP2 Fenton et al., 2012 N/A Primers for Real Time PCR, see Table S2 This paper N/A Software and Algorithms MUSE Doshi et al., 2016 www.med.upenn.edu/sbia/muse.html FLIRT Jenkinson et al., 2002 fsl.fmrib.ox.ac.uk Cancer Imaging Phenomics Toolkit (CaPTk) Davatzikos et al., (2018) www.med.upenn.edu/sbia/captk.html GLISTRboost Bakas et al., 2016 , Bakas et al., 2017b ipp.cbica.upenn.edu http://www.med.upenn.edu/sbia/glistrboost.html ITK-SNAP Yushkevich et al., 2006 www.itksnap.org ParaView Hansen and Johnson, 2005 www.paraview.org Open in a separate window KEY RESOURCES TABLE Epidermal growth factor receptor (EGFR) extracellular domain (ECD) missense mutations at A289 confer increased invasiveness, increased proliferation, and decreased patient survival in glioblastoma (GBM).

Techniques: Expressing, Control

Journal: Cancer cell

Article Title: Epidermal Growth Factor Receptor Extracellular Domain Mutations in Glioblastoma Present Opportunities for Clinical Imaging and Therapeutic Development

doi: 10.1016/j.ccell.2018.06.006

Figure Lengend Snippet: (A and B) Fluorescent-activated cell sorter analysis of U87 glioma cells (A) and HK281 GBM-spheres (B) expressing WT EGFR, EGFRvIII, or EGFRA289V. Serum-starved cells were incubated with either mAb806 or mAb528 (1 μg/1 × 106 cells) followed by secondary staining with a fluorescein isothiocyanate-conjugated antibody. Results are shown as mAb806 staining normalized to mAb528 (total EGFR).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies EGFR antibody BD Biosciences 61007 Pan-phospho-Tyrosine HRP antibody R&D Systems HAM1676 p42/44 MAPK antibody Cell Signaling Technology 9102 Phospho-p42/44 MAPK antibody Cell Signaling Technology 9101 STAT3 antibody Cell Signaling Technology 4904 Phospho-STAT3 y705 antibody Cell Signaling Technology 9145 AKT antibody Cell Signaling Technology 9272 Phospho-AKT s473 Cell Signaling Technology 4060 Ki67 Santa Cruz Biotechnology Sc-15402 β-Actin Sigma A 3854 mAb806 Biological Production Facility N/A BrdU (clone B44) antibody BD Biosciences BDB347580 Hoechst 33258 Sigma-Aldrich B2883 Bacterial and Virus Strains pLRNL vector Nishikawa et al., 1994 N/A pLV-EF1a-MCS-IRES-Hyg Biosettia cDNA-pLV02 iRFP720 cDNA Zanca et al., 2017 N/A Chemicals, Peptides, and Recombinant Proteins U0126 LC Laboratories U-6770 U0126 Cell Signaling Technology 9903S PD98059 LC Laboratories P-4313 Experimental Models: Cell Lines Human: U87 cells ATCC HTB-14 Human: HK281 GBM-spheres Laboratory of Harley Kornblum, UCLA N/A Experimental Models: Organisms/Strains Mouse: Female NCI Ath/Nu Charles River Labs Strain 563 Mouse: Female J:NU Homozygous The Jackson Laboratory 007850 Oligonucleotides shRNA targeting sequence: shMMP1: CCGGGC TAACCTTTGATGCTATAACCTCGAGGTTATAGC ATCAAAGGTTAGCTTTTTG Sigma TRCN0000372933 shControl: pLKO.1shGFP2 Fenton et al., 2012 N/A Primers for Real Time PCR, see Table S2 This paper N/A Software and Algorithms MUSE Doshi et al., 2016 www.med.upenn.edu/sbia/muse.html FLIRT Jenkinson et al., 2002 fsl.fmrib.ox.ac.uk Cancer Imaging Phenomics Toolkit (CaPTk) Davatzikos et al., (2018) www.med.upenn.edu/sbia/captk.html GLISTRboost Bakas et al., 2016 , Bakas et al., 2017b ipp.cbica.upenn.edu http://www.med.upenn.edu/sbia/glistrboost.html ITK-SNAP Yushkevich et al., 2006 www.itksnap.org ParaView Hansen and Johnson, 2005 www.paraview.org Open in a separate window KEY RESOURCES TABLE Epidermal growth factor receptor (EGFR) extracellular domain (ECD) missense mutations at A289 confer increased invasiveness, increased proliferation, and decreased patient survival in glioblastoma (GBM).

Techniques: Expressing, Incubation, Staining

Journal: Cancer cell

Article Title: Epidermal Growth Factor Receptor Extracellular Domain Mutations in Glioblastoma Present Opportunities for Clinical Imaging and Therapeutic Development

doi: 10.1016/j.ccell.2018.06.006

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies EGFR antibody BD Biosciences 61007 Pan-phospho-Tyrosine HRP antibody R&D Systems HAM1676 p42/44 MAPK antibody Cell Signaling Technology 9102 Phospho-p42/44 MAPK antibody Cell Signaling Technology 9101 STAT3 antibody Cell Signaling Technology 4904 Phospho-STAT3 y705 antibody Cell Signaling Technology 9145 AKT antibody Cell Signaling Technology 9272 Phospho-AKT s473 Cell Signaling Technology 4060 Ki67 Santa Cruz Biotechnology Sc-15402 β-Actin Sigma A 3854 mAb806 Biological Production Facility N/A BrdU (clone B44) antibody BD Biosciences BDB347580 Hoechst 33258 Sigma-Aldrich B2883 Bacterial and Virus Strains pLRNL vector Nishikawa et al., 1994 N/A pLV-EF1a-MCS-IRES-Hyg Biosettia cDNA-pLV02 iRFP720 cDNA Zanca et al., 2017 N/A Chemicals, Peptides, and Recombinant Proteins U0126 LC Laboratories U-6770 U0126 Cell Signaling Technology 9903S PD98059 LC Laboratories P-4313 Experimental Models: Cell Lines Human: U87 cells ATCC HTB-14 Human: HK281 GBM-spheres Laboratory of Harley Kornblum, UCLA N/A Experimental Models: Organisms/Strains Mouse: Female NCI Ath/Nu Charles River Labs Strain 563 Mouse: Female J:NU Homozygous The Jackson Laboratory 007850 Oligonucleotides shRNA targeting sequence: shMMP1: CCGGGC TAACCTTTGATGCTATAACCTCGAGGTTATAGC ATCAAAGGTTAGCTTTTTG Sigma TRCN0000372933 shControl: pLKO.1shGFP2 Fenton et al., 2012 N/A Primers for Real Time PCR, see Table S2 This paper N/A Software and Algorithms MUSE Doshi et al., 2016 www.med.upenn.edu/sbia/muse.html FLIRT Jenkinson et al., 2002 fsl.fmrib.ox.ac.uk Cancer Imaging Phenomics Toolkit (CaPTk) Davatzikos et al., (2018) www.med.upenn.edu/sbia/captk.html GLISTRboost Bakas et al., 2016 , Bakas et al., 2017b ipp.cbica.upenn.edu http://www.med.upenn.edu/sbia/glistrboost.html ITK-SNAP Yushkevich et al., 2006 www.itksnap.org ParaView Hansen and Johnson, 2005 www.paraview.org Open in a separate window KEY RESOURCES TABLE Epidermal growth factor receptor (EGFR) extracellular domain (ECD) missense mutations at A289 confer increased invasiveness, increased proliferation, and decreased patient survival in glioblastoma (GBM).

Techniques: Virus, Plasmid Preparation, Recombinant, shRNA, Sequencing, Real-time Polymerase Chain Reaction, Software, Imaging